All Compound Repeats of Taenia martis mitochondrial DNA
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_020153 | (TTTG)3 | p4 | 2642 | 2653 | 12 | Design Primer |
2 | NC_020153 | (TTAT)3tggtcaagtttttagtattcttttggttttatta(TTAT)3 | c | 3966 | 4023 | 58 | Design Primer |
3 | NC_020153 | (TATT)3 | p4 | 8093 | 8104 | 12 | Design Primer |
4 | NC_020153 | (T)10 | p1 | 9202 | 9211 | 10 | Design Primer |
5 | NC_020153 | (TTTA)3 | p4 | 11300 | 11311 | 12 | Design Primer |