All Compound Repeats of Ilyoplax deschampsi mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_020040 | (A)10 | p1 | 10255 | 10264 | 10 | Design Primer |
| 2 | NC_020040 | (CTAA)3 | p4 | 13203 | 13214 | 12 | Design Primer |
| 3 | NC_020040 | (ATAA)3cttttataaatattatttgtatatatatacatatataactataactctagtattttttc(T)10 | c | 13915 | 13995 | 81 | Design Primer |