All Compound Repeats of Mauremys reevesii mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_016681 | (AACA)3 | p4 | 975 | 986 | 12 | Design Primer |
2 | NC_016681 | (C)14 | p1 | 1679 | 1692 | 14 | Design Primer |
3 | NC_016681 | (GCA)4 | p3 | 8745 | 8756 | 12 | Design Primer |
4 | NC_016681 | (AAAAC)3 | p5 | 14131 | 14145 | 15 | Design Primer |
5 | NC_016681 | (T)10 | p1 | 16036 | 16045 | 10 | Design Primer |
6 | NC_016681 | (TATAC)7(TATAT)9(ATTAT)7atcatattatatcatattatatcatattatatcatattatatc(ATATT)3atatcatatatcatatatcatatatcatatatcatatattatatattatatattatatattatatattatatatc(ATTAT)12(TAT)4*attattatattatatc(AT)14 | c* | 16426 | 16783 | 358 | Design Primer |