All Compound Repeats of Sinentomon erythranum mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_015982 | (T)10 | p1 | 317 | 326 | 10 | Design Primer |
2 | NC_015982 | (AGGA)3 | p4 | 777 | 788 | 12 | Design Primer |
3 | NC_015982 | (T)10 | p1 | 2506 | 2515 | 10 | Design Primer |
4 | NC_015982 | (T)14 | p1 | 2648 | 2661 | 14 | Design Primer |
5 | NC_015982 | (T)11 | p1 | 2986 | 2996 | 11 | Design Primer |
6 | NC_015982 | (T)27 | p1 | 3213 | 3239 | 27 | Design Primer |
7 | NC_015982 | (T)15 | p1 | 3362 | 3376 | 15 | Design Primer |
8 | NC_015982 | (T)10gg(T)12 | c | 3588 | 3611 | 24 | Design Primer |
9 | NC_015982 | (TTTA)3ttttttgtttg(T)10 | c | 3934 | 3966 | 33 | Design Primer |
10 | NC_015982 | (T)14 | p1 | 4191 | 4204 | 14 | Design Primer |
11 | NC_015982 | (TTA)4gtaa(TAT)5 | c | 4848 | 4878 | 31 | Design Primer |
12 | NC_015982 | (ATT)5 | p3 | 6149 | 6163 | 15 | Design Primer |
13 | NC_015982 | (TTA)4 | p3 | 6445 | 6456 | 12 | Design Primer |
14 | NC_015982 | (TTA)4 | p3 | 7638 | 7649 | 12 | Design Primer |
15 | NC_015982 | (T)15atgttttgatcatcctttaatttttagtgttggtgttgtttttagttctttttatcttagagttttttttta(T)10aattcttgatttagatacattttgttttttatttttattggtggtattatgattttatttttgtatatttgttctttagtttttaatgagaagtttgt(TTTTTA)3(T)10gg(T)10gtgggagttctttgatgttctttgagggggtttgatgattttgttag(ATTT)3 | c | 7882 | 8175 | 294 | Design Primer |
16 | NC_015982 | (AATTT)3 | p5 | 8776 | 8790 | 15 | Design Primer |
17 | NC_015982 | (T)14 | p1 | 9394 | 9407 | 14 | Design Primer |
18 | NC_015982 | (T)14 | p1 | 9544 | 9557 | 14 | Design Primer |
19 | NC_015982 | (T)10atttttttttatttcagtttatttctc(T)10 | c | 9981 | 10027 | 47 | Design Primer |
20 | NC_015982 | (T)10 | p1 | 10167 | 10176 | 10 | Design Primer |
21 | NC_015982 | (T)10gactttattattaattattta(T)10aggtga(AATTT)3 | c | 10620 | 10681 | 62 | Design Primer |
22 | NC_015982 | (TTATTT)3 | p6 | 11499 | 11516 | 18 | Design Primer |
23 | NC_015982 | (T)11 | p1 | 11810 | 11820 | 11 | Design Primer |
24 | NC_015982 | (T)11 | p1 | 11923 | 11933 | 11 | Design Primer |
25 | NC_015982 | (T)11 | p1 | 12152 | 12162 | 11 | Design Primer |
26 | NC_015982 | (T)10gttaaggattttcaggaatttttttgagggggttttttatctttgttta(T)17 | c | 12780 | 12855 | 76 | Design Primer |
27 | NC_015982 | (T)10aatttgtttgggggggttttcttttatttttagaattttttttg(T)10 | c | 13007 | 13070 | 64 | Design Primer |
28 | NC_015982 | (T)12 | p1 | 13342 | 13353 | 12 | Design Primer |
29 | NC_015982 | (ATTTT)3ttcttatttttggggttatatttaatttatatgtttatttacgttttatttattctagaattaa(T)12aaggtggtttagtttttttg(ATT)4tttattggttta(T)13attttgttt(TA)6 | c | 14043 | 14211 | 169 | Design Primer |