All Compound Repeats of Bittacus pilicornis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015118 | (ATCA)3 | p4 | 743 | 754 | 12 | Design Primer |
| 2 | NC_015118 | (T)10 | p1 | 5813 | 5822 | 10 | Design Primer |
| 3 | NC_015118 | (AAT)5 | p3 | 9557 | 9571 | 15 | Design Primer |
| 4 | NC_015118 | (TTAT)3 | p4 | 10025 | 10036 | 12 | Design Primer |
| 5 | NC_015118 | (ATTA)3 | p4 | 14468 | 14479 | 12 | Design Primer |
| 6 | NC_015118 | (TTAA)5 | p4 | 15046 | 15065 | 20 | Design Primer |
| 7 | NC_015118 | (T)12 | p1 | 15169 | 15180 | 12 | Design Primer |
| 8 | NC_015118 | (AT)7 | p2 | 15327 | 15340 | 14 | Design Primer |
| 9 | NC_015118 | (TC)7accttatccagctgtcagggctatagttgggatgtatatttattaaaatcttattattaaataaatcttgcttttctagt(AATA)3attagaattttgaaatatt(TTA)4(TA)7* | c* | 15460 | 15608 | 149 | Design Primer |