All Compound Repeats of Mauremys megalocephala mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_015101 | (AACA)3 | p4 | 975 | 986 | 12 | Design Primer |
2 | NC_015101 | (C)10 | p1 | 1678 | 1687 | 10 | Design Primer |
3 | NC_015101 | (GCA)4 | p3 | 8744 | 8755 | 12 | Design Primer |
4 | NC_015101 | (AAAAC)3 | p5 | 14131 | 14145 | 15 | Design Primer |
5 | NC_015101 | (T)10 | p1 | 16037 | 16046 | 10 | Design Primer |
6 | NC_015101 | (TTATA)22(ATATT)3atatcatattatatcatattatatcatattatatc(ATATT)5atatc(ATATT)8atatc(ATATT)6atatattattatattattatattattatattattatattattatattattatattatatcatatatc(AT)13 | c | 16426 | 16783 | 358 | Design Primer |