All Compound Repeats of Euphaea formosa mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_014493 | (AAAC)4 | p4 | 3215 | 3230 | 16 | Design Primer |
| 2 | NC_014493 | (AAAT)3 | p4 | 8168 | 8179 | 12 | Design Primer |
| 3 | NC_014493 | (AAAT)3 | p4 | 13895 | 13906 | 12 | Design Primer |
| 4 | NC_014493 | (TA)6agttcttattataataaatacttatactattataaaataattattaattctttctctaaattttat(TTTA)3aatattgatttataaattagcttttattattaaatctttggataactctattaattattatattat(TA)6 | c | 15358 | 15525 | 168 | Design Primer |