All Compound Repeats of Hydrosaurus amboinensis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_014178 | (CTA)4 | p3 | 5584 | 5595 | 12 | Design Primer |
| 2 | NC_014178 | (CTA)4 | p3 | 5584 | 5595 | 12 | Design Primer |
| 3 | NC_014178 | (AAC)4 | p3 | 8659 | 8670 | 12 | Design Primer |
| 4 | NC_014178 | (AAC)4 | p3 | 8659 | 8670 | 12 | Design Primer |
| 5 | NC_014178 | (CAAA)3aatttataaaatacctcctaacattcataatctctatatcc(CTA)4 | c | 12001 | 12065 | 65 | Design Primer |
| 6 | NC_014178 | (CAAA)3aatttataaaatacctcctaacattcataatctctatatcc(CTA)4 | c | 12001 | 12065 | 65 | Design Primer |
| 7 | NC_014178 | (T)10 | p1 | 15771 | 15780 | 10 | Design Primer |
| 8 | NC_014178 | (AT)12 | p2 | 16008 | 16031 | 24 | Design Primer |
| 9 | NC_014178 | (AT)12 | p2 | 16008 | 16031 | 24 | Design Primer |