All Compound Repeats of Leptoderma retropinna mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_013559 | (CA)7 | p2 | 1914 | 1927 | 14 | Design Primer |
2 | NC_013559 | (CTC)4 | p3 | 5790 | 5801 | 12 | Design Primer |
3 | NC_013559 | (TTA)4cccgatgaggaaatcaaacggaacgccttaacgcaggaacatacttcctattttatactctcgcaggctctcttcctttattggttgc(CCT)4 | c | 10736 | 10847 | 112 | Design Primer |