All Compound Repeats of Cephalothrix simula mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_012821 | (TATAAA)3tatcctaagaaattaagaaaaaaatatattatttttttcttaatttcttagg(ATATTT)3 | c | 147 | 234 | 88 | Design Primer |
2 | NC_012821 | (TATTTT)4 | p6 | 852 | 875 | 24 | Design Primer |
3 | NC_012821 | (ATAAG)3 | p5 | 2886 | 2900 | 15 | Design Primer |
4 | NC_012821 | (T)12 | p1 | 3965 | 3976 | 12 | Design Primer |