All Compound Repeats of Chrysochroa fulgidissima mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_012765 | (AAT)5 | p3 | 5534 | 5548 | 15 | Design Primer |
2 | NC_012765 | (T)21atataaatatttaatttattattatgattacattcct(TA)8 | c | 15008 | 15081 | 74 | Design Primer |
3 | NC_012765 | (A)14 | p1 | 15455 | 15468 | 14 | Design Primer |