All Compound Repeats of Chamaeleo zeylanicus mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_012444 | (TTCA)3 | p4 | 12634 | 12645 | 12 | Design Primer |
2 | NC_012444 | (CAA)4 | p3 | 14683 | 14694 | 12 | Design Primer |
3 | NC_012444 | (TA)9caaaaagataatatgcaagatcttgcatattatctttc(AT)7 | c | 18788 | 18857 | 70 | Design Primer |