All Compound Repeats of Nothopuga sp. 1 LP-2008 mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_009984 | (TTC)4 | p3 | 575 | 586 | 12 | Design Primer |
| 2 | NC_009984 | (AATAA)3 | p5 | 4752 | 4766 | 15 | Design Primer |
| 3 | NC_009984 | (AATA)3 | p4 | 5309 | 5320 | 12 | Design Primer |
| 4 | NC_009984 | (ATA)4 | p3 | 8473 | 8484 | 12 | Design Primer |
| 5 | NC_009984 | (ACAA)3 | p4 | 12807 | 12818 | 12 | Design Primer |
| 6 | NC_009984 | (TA)7aatgttgaattattattcagcaactaattacaatcccgtgacatcaatctgattaaaatttgacctatttacccc(TCTT)3 | c | 13338 | 13438 | 101 | Design Primer |