All Compound Repeats of Epiperipatus biolleyi mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_009082 | (TAT)4 | p3 | 4667 | 4678 | 12 | Design Primer |
| 2 | NC_009082 | (TTTA)3ttcatctattggccatgttgggtgaataattgttgctattttattaagtgatgatgtttgaattgtttattattcattttattttgtt(ATA)4 | c | 4930 | 5041 | 112 | Design Primer |
| 3 | NC_009082 | (TA)6 | p2 | 14057 | 14068 | 12 | Design Primer |