All Compound Repeats of Bactrocera dorsalis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_008748 | (AAAT)3 | p4 | 13700 | 13711 | 12 | Design Primer |
| 2 | NC_008748 | (T)20 | p1 | 15350 | 15369 | 20 | Design Primer |
| 3 | NC_008748 | (AT)7gtatataaatat(TTAA)3 | c | 15500 | 15537 | 38 | Design Primer |
| 4 | NC_008748 | (TTTA)3aatattaaaacatatatttacatttaagttacatacaccacttaaatgtaagtat(A)22 | c | 15781 | 15869 | 89 | Design Primer |