All Compound Repeats of Testudo horsfieldii mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_007697 | (GCA)4 | p3 | 8747 | 8758 | 12 | Design Primer |
2 | NC_007697 | (AAAAC)3 | p5 | 14114 | 14128 | 15 | Design Primer |
3 | NC_007697 | (AATCTC)17 | p6 | 16171 | 16272 | 102 | Design Primer |
4 | NC_007697 | (TA)6tgtcatttaagatatattatactgtgtagtactatactaacctatatattatattatttattaagagtatac(TA)6 | c | 16577 | 16672 | 96 | Design Primer |