All Compound Repeats of Neogymnocrinus richeri mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_007689 | (GTTT)3 | p4 | 3716 | 3727 | 12 | Design Primer |
2 | NC_007689 | (TTTG)3gtctgtttttattactactt(TTC)4 | c | 7711 | 7754 | 44 | Design Primer |
3 | NC_007689 | (TTA)4 | p3 | 15939 | 15950 | 12 | Design Primer |