All Compound Repeats of Aneides hardii mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_006338 | (ATTT)3 | p4 | 6077 | 6088 | 12 | Design Primer |
2 | NC_006338 | (TAA)4atctttcctcaactgatataaataaaatagcctcatcatgaataaaaaatcttcccattgcctcagc(AAT)4 | c | 9080 | 9170 | 91 | Design Primer |
3 | NC_006338 | (C)13 | p1 | 19416 | 19428 | 13 | Design Primer |
4 | NC_006338 | (ATTT)3 | p4 | 21250 | 21261 | 12 | Design Primer |