All Compound Repeats of Katharina tunicata mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_001636 | (TTTG)3 | p4 | 537 | 548 | 12 | Design Primer |
| 2 | NC_001636 | (AATT)3 | p4 | 12299 | 12310 | 12 | Design Primer |
| 3 | NC_001636 | (TA)37atagaatatgaccatatatttatatatcttaaagtgctagc(A)18 | c | 12819 | 12951 | 133 | Design Primer |